ID: 937539021

View in Genome Browser
Species Human (GRCh38)
Location 2:122925666-122925688
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937539016_937539021 12 Left 937539016 2:122925631-122925653 CCAGTCACTTCTGTCTGGTGGGA No data
Right 937539021 2:122925666-122925688 TGGGGCCTGCAGCAGCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type