ID: 937541912

View in Genome Browser
Species Human (GRCh38)
Location 2:122966137-122966159
Sequence TAACCTTCCCCCACTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937541910_937541912 0 Left 937541910 2:122966114-122966136 CCATTTCGTCTGAGATTCCTAAG No data
Right 937541912 2:122966137-122966159 TAACCTTCCCCCACTGCTTCAGG No data
937541909_937541912 17 Left 937541909 2:122966097-122966119 CCATGGACACTGACGTTCCATTT No data
Right 937541912 2:122966137-122966159 TAACCTTCCCCCACTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937541912 Original CRISPR TAACCTTCCCCCACTGCTTC AGG Intergenic
No off target data available for this crispr