ID: 937542885

View in Genome Browser
Species Human (GRCh38)
Location 2:122981199-122981221
Sequence CTGGAGATACAGATCAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937542883_937542885 11 Left 937542883 2:122981165-122981187 CCTAATGTTTCATTTTTTTTTGA No data
Right 937542885 2:122981199-122981221 CTGGAGATACAGATCAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937542885 Original CRISPR CTGGAGATACAGATCAAATC AGG Intergenic
No off target data available for this crispr