ID: 937553016

View in Genome Browser
Species Human (GRCh38)
Location 2:123118148-123118170
Sequence ATCTTGCTCTGGTTTTCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937553009_937553016 19 Left 937553009 2:123118106-123118128 CCAGTACTATGTTGAATAGGAGT No data
Right 937553016 2:123118148-123118170 ATCTTGCTCTGGTTTTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937553016 Original CRISPR ATCTTGCTCTGGTTTTCAAG GGG Intergenic