ID: 937553907

View in Genome Browser
Species Human (GRCh38)
Location 2:123130970-123130992
Sequence CTGGATATTCAGAAAAGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937553907_937553909 -1 Left 937553907 2:123130970-123130992 CCATGACTTTTCTGAATATCCAG No data
Right 937553909 2:123130992-123131014 GCTTGCAGATGACACATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937553907 Original CRISPR CTGGATATTCAGAAAAGTCA TGG (reversed) Intergenic
No off target data available for this crispr