ID: 937553909

View in Genome Browser
Species Human (GRCh38)
Location 2:123130992-123131014
Sequence GCTTGCAGATGACACATCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937553907_937553909 -1 Left 937553907 2:123130970-123130992 CCATGACTTTTCTGAATATCCAG No data
Right 937553909 2:123130992-123131014 GCTTGCAGATGACACATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937553909 Original CRISPR GCTTGCAGATGACACATCAC AGG Intergenic
No off target data available for this crispr