ID: 937558520

View in Genome Browser
Species Human (GRCh38)
Location 2:123190988-123191010
Sequence TGCATAATTATGTTTAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937558520_937558522 5 Left 937558520 2:123190988-123191010 CCCTTCTTAAACATAATTATGCA No data
Right 937558522 2:123191016-123191038 CTACCATCCAGAATCAATTAAGG No data
937558520_937558526 30 Left 937558520 2:123190988-123191010 CCCTTCTTAAACATAATTATGCA No data
Right 937558526 2:123191041-123191063 GGATATCACATTTAATTTTATGG No data
937558520_937558524 9 Left 937558520 2:123190988-123191010 CCCTTCTTAAACATAATTATGCA No data
Right 937558524 2:123191020-123191042 CATCCAGAATCAATTAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937558520 Original CRISPR TGCATAATTATGTTTAAGAA GGG (reversed) Intergenic
No off target data available for this crispr