ID: 937558521

View in Genome Browser
Species Human (GRCh38)
Location 2:123190989-123191011
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937558521_937558526 29 Left 937558521 2:123190989-123191011 CCTTCTTAAACATAATTATGCAA No data
Right 937558526 2:123191041-123191063 GGATATCACATTTAATTTTATGG No data
937558521_937558522 4 Left 937558521 2:123190989-123191011 CCTTCTTAAACATAATTATGCAA No data
Right 937558522 2:123191016-123191038 CTACCATCCAGAATCAATTAAGG No data
937558521_937558524 8 Left 937558521 2:123190989-123191011 CCTTCTTAAACATAATTATGCAA No data
Right 937558524 2:123191020-123191042 CATCCAGAATCAATTAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937558521 Original CRISPR TTGCATAATTATGTTTAAGA AGG (reversed) Intergenic