ID: 937558522

View in Genome Browser
Species Human (GRCh38)
Location 2:123191016-123191038
Sequence CTACCATCCAGAATCAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937558520_937558522 5 Left 937558520 2:123190988-123191010 CCCTTCTTAAACATAATTATGCA No data
Right 937558522 2:123191016-123191038 CTACCATCCAGAATCAATTAAGG No data
937558521_937558522 4 Left 937558521 2:123190989-123191011 CCTTCTTAAACATAATTATGCAA No data
Right 937558522 2:123191016-123191038 CTACCATCCAGAATCAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937558522 Original CRISPR CTACCATCCAGAATCAATTA AGG Intergenic
No off target data available for this crispr