ID: 937558523

View in Genome Browser
Species Human (GRCh38)
Location 2:123191019-123191041
Sequence CAACCTTAATTGATTCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937558523_937558526 -1 Left 937558523 2:123191019-123191041 CCATCCAGAATCAATTAAGGTTG No data
Right 937558526 2:123191041-123191063 GGATATCACATTTAATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937558523 Original CRISPR CAACCTTAATTGATTCTGGA TGG (reversed) Intergenic
No off target data available for this crispr