ID: 937558524

View in Genome Browser
Species Human (GRCh38)
Location 2:123191020-123191042
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937558520_937558524 9 Left 937558520 2:123190988-123191010 CCCTTCTTAAACATAATTATGCA No data
Right 937558524 2:123191020-123191042 CATCCAGAATCAATTAAGGTTGG No data
937558521_937558524 8 Left 937558521 2:123190989-123191011 CCTTCTTAAACATAATTATGCAA No data
Right 937558524 2:123191020-123191042 CATCCAGAATCAATTAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr