ID: 937558526

View in Genome Browser
Species Human (GRCh38)
Location 2:123191041-123191063
Sequence GGATATCACATTTAATTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937558525_937558526 -5 Left 937558525 2:123191023-123191045 CCAGAATCAATTAAGGTTGGATA No data
Right 937558526 2:123191041-123191063 GGATATCACATTTAATTTTATGG No data
937558523_937558526 -1 Left 937558523 2:123191019-123191041 CCATCCAGAATCAATTAAGGTTG No data
Right 937558526 2:123191041-123191063 GGATATCACATTTAATTTTATGG No data
937558520_937558526 30 Left 937558520 2:123190988-123191010 CCCTTCTTAAACATAATTATGCA No data
Right 937558526 2:123191041-123191063 GGATATCACATTTAATTTTATGG No data
937558521_937558526 29 Left 937558521 2:123190989-123191011 CCTTCTTAAACATAATTATGCAA No data
Right 937558526 2:123191041-123191063 GGATATCACATTTAATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937558526 Original CRISPR GGATATCACATTTAATTTTA TGG Intergenic
No off target data available for this crispr