ID: 937560440

View in Genome Browser
Species Human (GRCh38)
Location 2:123218184-123218206
Sequence AACAATATGAAGTTAATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937560440_937560441 5 Left 937560440 2:123218184-123218206 CCTGGTATTAACTTCATATTGTT No data
Right 937560441 2:123218212-123218234 CGCTAAAATAGACACTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937560440 Original CRISPR AACAATATGAAGTTAATACC AGG (reversed) Intergenic
No off target data available for this crispr