ID: 937561551

View in Genome Browser
Species Human (GRCh38)
Location 2:123230924-123230946
Sequence CCTGCTTTGGTGAAGGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937561546_937561551 -8 Left 937561546 2:123230909-123230931 CCATGGATAACAGCACCTGCTTT No data
Right 937561551 2:123230924-123230946 CCTGCTTTGGTGAAGGTGGTAGG No data
937561544_937561551 11 Left 937561544 2:123230890-123230912 CCGTCTTCAGGTCTCTCTACCAT No data
Right 937561551 2:123230924-123230946 CCTGCTTTGGTGAAGGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937561551 Original CRISPR CCTGCTTTGGTGAAGGTGGT AGG Intergenic
No off target data available for this crispr