ID: 937561551 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:123230924-123230946 |
Sequence | CCTGCTTTGGTGAAGGTGGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937561546_937561551 | -8 | Left | 937561546 | 2:123230909-123230931 | CCATGGATAACAGCACCTGCTTT | No data | ||
Right | 937561551 | 2:123230924-123230946 | CCTGCTTTGGTGAAGGTGGTAGG | No data | ||||
937561544_937561551 | 11 | Left | 937561544 | 2:123230890-123230912 | CCGTCTTCAGGTCTCTCTACCAT | No data | ||
Right | 937561551 | 2:123230924-123230946 | CCTGCTTTGGTGAAGGTGGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937561551 | Original CRISPR | CCTGCTTTGGTGAAGGTGGT AGG | Intergenic | ||
No off target data available for this crispr |