ID: 937572476

View in Genome Browser
Species Human (GRCh38)
Location 2:123380987-123381009
Sequence GCGGCTGCTGTGAGAGATAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937572476_937572479 -5 Left 937572476 2:123380987-123381009 CCCCTATCTCTCACAGCAGCCGC No data
Right 937572479 2:123381005-123381027 GCCGCAGCAAGCCCTGCCCAAGG 0: 6
1: 76
2: 189
3: 318
4: 612

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937572476 Original CRISPR GCGGCTGCTGTGAGAGATAG GGG (reversed) Intergenic
No off target data available for this crispr