ID: 937579761

View in Genome Browser
Species Human (GRCh38)
Location 2:123470531-123470553
Sequence CTGTGTATGTCAAAGTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937579756_937579761 6 Left 937579756 2:123470502-123470524 CCAGAAAGTCCATGCCTGTCATT No data
Right 937579761 2:123470531-123470553 CTGTGTATGTCAAAGTAAGAGGG No data
937579759_937579761 -8 Left 937579759 2:123470516-123470538 CCTGTCATTAACGGTCTGTGTAT No data
Right 937579761 2:123470531-123470553 CTGTGTATGTCAAAGTAAGAGGG No data
937579758_937579761 -3 Left 937579758 2:123470511-123470533 CCATGCCTGTCATTAACGGTCTG No data
Right 937579761 2:123470531-123470553 CTGTGTATGTCAAAGTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937579761 Original CRISPR CTGTGTATGTCAAAGTAAGA GGG Intergenic
No off target data available for this crispr