ID: 937582066

View in Genome Browser
Species Human (GRCh38)
Location 2:123499196-123499218
Sequence AGTTCTCTGCAGAAGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937582062_937582066 22 Left 937582062 2:123499151-123499173 CCAAAGCCTAGTAATGGGCCAAG No data
Right 937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG No data
937582061_937582066 25 Left 937582061 2:123499148-123499170 CCACCAAAGCCTAGTAATGGGCC No data
Right 937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG No data
937582065_937582066 4 Left 937582065 2:123499169-123499191 CCAAGAACTGTCTCTCAAAAGGA No data
Right 937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG No data
937582063_937582066 16 Left 937582063 2:123499157-123499179 CCTAGTAATGGGCCAAGAACTGT No data
Right 937582066 2:123499196-123499218 AGTTCTCTGCAGAAGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937582066 Original CRISPR AGTTCTCTGCAGAAGAAGAC AGG Intergenic
No off target data available for this crispr