ID: 937584315

View in Genome Browser
Species Human (GRCh38)
Location 2:123527380-123527402
Sequence CCCTCACCAGGAGGAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937584315_937584325 13 Left 937584315 2:123527380-123527402 CCAGCATCTCCTCCTGGTGAGGG No data
Right 937584325 2:123527416-123527438 CCACTTACTGTGGAAGGGGAAGG No data
937584315_937584321 7 Left 937584315 2:123527380-123527402 CCAGCATCTCCTCCTGGTGAGGG No data
Right 937584321 2:123527410-123527432 CTGCTTCCACTTACTGTGGAAGG No data
937584315_937584320 3 Left 937584315 2:123527380-123527402 CCAGCATCTCCTCCTGGTGAGGG No data
Right 937584320 2:123527406-123527428 GAAGCTGCTTCCACTTACTGTGG No data
937584315_937584326 14 Left 937584315 2:123527380-123527402 CCAGCATCTCCTCCTGGTGAGGG No data
Right 937584326 2:123527417-123527439 CACTTACTGTGGAAGGGGAAGGG No data
937584315_937584327 15 Left 937584315 2:123527380-123527402 CCAGCATCTCCTCCTGGTGAGGG No data
Right 937584327 2:123527418-123527440 ACTTACTGTGGAAGGGGAAGGGG No data
937584315_937584328 20 Left 937584315 2:123527380-123527402 CCAGCATCTCCTCCTGGTGAGGG No data
Right 937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG No data
937584315_937584322 8 Left 937584315 2:123527380-123527402 CCAGCATCTCCTCCTGGTGAGGG No data
Right 937584322 2:123527411-123527433 TGCTTCCACTTACTGTGGAAGGG No data
937584315_937584323 9 Left 937584315 2:123527380-123527402 CCAGCATCTCCTCCTGGTGAGGG No data
Right 937584323 2:123527412-123527434 GCTTCCACTTACTGTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937584315 Original CRISPR CCCTCACCAGGAGGAGATGC TGG (reversed) Intergenic
No off target data available for this crispr