ID: 937584318

View in Genome Browser
Species Human (GRCh38)
Location 2:123527392-123527414
Sequence AGCAGCTTCAGGCCCTCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937584318_937584328 8 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG No data
937584318_937584321 -5 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584321 2:123527410-123527432 CTGCTTCCACTTACTGTGGAAGG No data
937584318_937584325 1 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584325 2:123527416-123527438 CCACTTACTGTGGAAGGGGAAGG No data
937584318_937584330 28 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584330 2:123527443-123527465 TGGCATGTGCAGACATCACAGGG No data
937584318_937584326 2 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584326 2:123527417-123527439 CACTTACTGTGGAAGGGGAAGGG No data
937584318_937584322 -4 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584322 2:123527411-123527433 TGCTTCCACTTACTGTGGAAGGG No data
937584318_937584327 3 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584327 2:123527418-123527440 ACTTACTGTGGAAGGGGAAGGGG No data
937584318_937584323 -3 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584323 2:123527412-123527434 GCTTCCACTTACTGTGGAAGGGG No data
937584318_937584329 27 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584329 2:123527442-123527464 ATGGCATGTGCAGACATCACAGG No data
937584318_937584320 -9 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584320 2:123527406-123527428 GAAGCTGCTTCCACTTACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937584318 Original CRISPR AGCAGCTTCAGGCCCTCACC AGG (reversed) Intergenic
No off target data available for this crispr