ID: 937584319

View in Genome Browser
Species Human (GRCh38)
Location 2:123527403-123527425
Sequence CAGTAAGTGGAAGCAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937584319_937584327 -8 Left 937584319 2:123527403-123527425 CCTGAAGCTGCTTCCACTTACTG No data
Right 937584327 2:123527418-123527440 ACTTACTGTGGAAGGGGAAGGGG No data
937584319_937584326 -9 Left 937584319 2:123527403-123527425 CCTGAAGCTGCTTCCACTTACTG No data
Right 937584326 2:123527417-123527439 CACTTACTGTGGAAGGGGAAGGG No data
937584319_937584328 -3 Left 937584319 2:123527403-123527425 CCTGAAGCTGCTTCCACTTACTG No data
Right 937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG No data
937584319_937584329 16 Left 937584319 2:123527403-123527425 CCTGAAGCTGCTTCCACTTACTG No data
Right 937584329 2:123527442-123527464 ATGGCATGTGCAGACATCACAGG No data
937584319_937584325 -10 Left 937584319 2:123527403-123527425 CCTGAAGCTGCTTCCACTTACTG No data
Right 937584325 2:123527416-123527438 CCACTTACTGTGGAAGGGGAAGG No data
937584319_937584330 17 Left 937584319 2:123527403-123527425 CCTGAAGCTGCTTCCACTTACTG No data
Right 937584330 2:123527443-123527465 TGGCATGTGCAGACATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937584319 Original CRISPR CAGTAAGTGGAAGCAGCTTC AGG (reversed) Intergenic
No off target data available for this crispr