ID: 937584328

View in Genome Browser
Species Human (GRCh38)
Location 2:123527423-123527445
Sequence CTGTGGAAGGGGAAGGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937584317_937584328 11 Left 937584317 2:123527389-123527411 CCTCCTGGTGAGGGCCTGAAGCT No data
Right 937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG No data
937584319_937584328 -3 Left 937584319 2:123527403-123527425 CCTGAAGCTGCTTCCACTTACTG No data
Right 937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG No data
937584318_937584328 8 Left 937584318 2:123527392-123527414 CCTGGTGAGGGCCTGAAGCTGCT No data
Right 937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG No data
937584315_937584328 20 Left 937584315 2:123527380-123527402 CCAGCATCTCCTCCTGGTGAGGG No data
Right 937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937584328 Original CRISPR CTGTGGAAGGGGAAGGGGAA TGG Intergenic
No off target data available for this crispr