ID: 937589536

View in Genome Browser
Species Human (GRCh38)
Location 2:123596437-123596459
Sequence TACCCAAGGCTACAACAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937589531_937589536 20 Left 937589531 2:123596394-123596416 CCATCCTCAAGACACAGAGACAG No data
Right 937589536 2:123596437-123596459 TACCCAAGGCTACAACAGTCAGG No data
937589533_937589536 16 Left 937589533 2:123596398-123596420 CCTCAAGACACAGAGACAGAGGA No data
Right 937589536 2:123596437-123596459 TACCCAAGGCTACAACAGTCAGG No data
937589530_937589536 26 Left 937589530 2:123596388-123596410 CCTACTCCATCCTCAAGACACAG No data
Right 937589536 2:123596437-123596459 TACCCAAGGCTACAACAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937589536 Original CRISPR TACCCAAGGCTACAACAGTC AGG Intergenic
No off target data available for this crispr