ID: 937589880

View in Genome Browser
Species Human (GRCh38)
Location 2:123600107-123600129
Sequence GTGGTCAGGGCCCTCATGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937589870_937589880 30 Left 937589870 2:123600054-123600076 CCTAGTGGGAAATGGCAGTAGGA No data
Right 937589880 2:123600107-123600129 GTGGTCAGGGCCCTCATGATTGG No data
937589876_937589880 0 Left 937589876 2:123600084-123600106 CCTTTGGGAGGAGATTAGGTAAT No data
Right 937589880 2:123600107-123600129 GTGGTCAGGGCCCTCATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937589880 Original CRISPR GTGGTCAGGGCCCTCATGAT TGG Intergenic
No off target data available for this crispr