ID: 937593826

View in Genome Browser
Species Human (GRCh38)
Location 2:123648610-123648632
Sequence GAGTTTTAAAATTACTATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937593826_937593827 13 Left 937593826 2:123648610-123648632 CCGTAATAGTAATTTTAAAACTC No data
Right 937593827 2:123648646-123648668 CATTCTCAACTAATCCCTATAGG No data
937593826_937593828 17 Left 937593826 2:123648610-123648632 CCGTAATAGTAATTTTAAAACTC No data
Right 937593828 2:123648650-123648672 CTCAACTAATCCCTATAGGTAGG No data
937593826_937593831 29 Left 937593826 2:123648610-123648632 CCGTAATAGTAATTTTAAAACTC No data
Right 937593831 2:123648662-123648684 CTATAGGTAGGAAGAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937593826 Original CRISPR GAGTTTTAAAATTACTATTA CGG (reversed) Intergenic
No off target data available for this crispr