ID: 937593831 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:123648662-123648684 |
| Sequence | CTATAGGTAGGAAGAGCAGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 937593826_937593831 | 29 | Left | 937593826 | 2:123648610-123648632 | CCGTAATAGTAATTTTAAAACTC | No data | ||
| Right | 937593831 | 2:123648662-123648684 | CTATAGGTAGGAAGAGCAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 937593831 | Original CRISPR | CTATAGGTAGGAAGAGCAGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||