ID: 937593831

View in Genome Browser
Species Human (GRCh38)
Location 2:123648662-123648684
Sequence CTATAGGTAGGAAGAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937593826_937593831 29 Left 937593826 2:123648610-123648632 CCGTAATAGTAATTTTAAAACTC No data
Right 937593831 2:123648662-123648684 CTATAGGTAGGAAGAGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937593831 Original CRISPR CTATAGGTAGGAAGAGCAGA TGG Intergenic
No off target data available for this crispr