ID: 937594968

View in Genome Browser
Species Human (GRCh38)
Location 2:123661568-123661590
Sequence CGGCAAACAGCTGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937594968_937594975 23 Left 937594968 2:123661568-123661590 CCGTCCACCACAGCTGTTTGCCG No data
Right 937594975 2:123661614-123661636 TCCACCCCTCCAGATCTGGCAGG 0: 10
1: 44
2: 86
3: 145
4: 272
937594968_937594974 19 Left 937594968 2:123661568-123661590 CCGTCCACCACAGCTGTTTGCCG No data
Right 937594974 2:123661610-123661632 GACTTCCACCCCTCCAGATCTGG 0: 21
1: 71
2: 95
3: 106
4: 191
937594968_937594977 24 Left 937594968 2:123661568-123661590 CCGTCCACCACAGCTGTTTGCCG No data
Right 937594977 2:123661615-123661637 CCACCCCTCCAGATCTGGCAGGG 0: 10
1: 42
2: 98
3: 150
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937594968 Original CRISPR CGGCAAACAGCTGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr