ID: 937598036

View in Genome Browser
Species Human (GRCh38)
Location 2:123693712-123693734
Sequence TTTGTTTAACACTTCATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937598036_937598038 27 Left 937598036 2:123693712-123693734 CCTTGCATGAAGTGTTAAACAAA No data
Right 937598038 2:123693762-123693784 TTGAAGTAGATTAGAAACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937598036 Original CRISPR TTTGTTTAACACTTCATGCA AGG (reversed) Intergenic
No off target data available for this crispr