ID: 937604321

View in Genome Browser
Species Human (GRCh38)
Location 2:123778892-123778914
Sequence CAATACACAACGATGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937604314_937604321 27 Left 937604314 2:123778842-123778864 CCAGAGATCTACAAATTAGAAAA No data
Right 937604321 2:123778892-123778914 CAATACACAACGATGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937604321 Original CRISPR CAATACACAACGATGGGACA AGG Intergenic
No off target data available for this crispr