ID: 937605195

View in Genome Browser
Species Human (GRCh38)
Location 2:123792080-123792102
Sequence TCTTATCTGTAGAATGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937605195_937605198 24 Left 937605195 2:123792080-123792102 CCATCTGCATTCTACAGATAAGA No data
Right 937605198 2:123792127-123792149 AAATATAAATAAAACAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937605195 Original CRISPR TCTTATCTGTAGAATGCAGA TGG (reversed) Intergenic
No off target data available for this crispr