ID: 937607181

View in Genome Browser
Species Human (GRCh38)
Location 2:123815156-123815178
Sequence TCCCAAAGTTCTGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937607181_937607188 -8 Left 937607181 2:123815156-123815178 CCAGCACTCCCAGAACTTTGGGA No data
Right 937607188 2:123815171-123815193 CTTTGGGAGGCCAAGGCGGGCGG 0: 17665
1: 104567
2: 162703
3: 161462
4: 107266
937607181_937607192 24 Left 937607181 2:123815156-123815178 CCAGCACTCCCAGAACTTTGGGA No data
Right 937607192 2:123815203-123815225 TCAGGAGTTCGAGACCATCCTGG 0: 1495
1: 111328
2: 224900
3: 198543
4: 123378
937607181_937607189 1 Left 937607181 2:123815156-123815178 CCAGCACTCCCAGAACTTTGGGA No data
Right 937607189 2:123815180-123815202 GCCAAGGCGGGCGGATCACAAGG 0: 808
1: 8480
2: 35893
3: 58783
4: 65038
937607181_937607191 6 Left 937607181 2:123815156-123815178 CCAGCACTCCCAGAACTTTGGGA No data
Right 937607191 2:123815185-123815207 GGCGGGCGGATCACAAGGTCAGG 0: 3749
1: 30143
2: 58764
3: 65465
4: 38630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937607181 Original CRISPR TCCCAAAGTTCTGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr