ID: 937609333

View in Genome Browser
Species Human (GRCh38)
Location 2:123840985-123841007
Sequence CTCTGCACAGGAATGCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937609333_937609338 -9 Left 937609333 2:123840985-123841007 CCCCACAGCATTCCTGTGCAGAG No data
Right 937609338 2:123840999-123841021 TGTGCAGAGATCTTGGTACAAGG No data
937609333_937609340 -7 Left 937609333 2:123840985-123841007 CCCCACAGCATTCCTGTGCAGAG No data
Right 937609340 2:123841001-123841023 TGCAGAGATCTTGGTACAAGGGG No data
937609333_937609339 -8 Left 937609333 2:123840985-123841007 CCCCACAGCATTCCTGTGCAGAG No data
Right 937609339 2:123841000-123841022 GTGCAGAGATCTTGGTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937609333 Original CRISPR CTCTGCACAGGAATGCTGTG GGG (reversed) Intergenic
No off target data available for this crispr