ID: 937613670

View in Genome Browser
Species Human (GRCh38)
Location 2:123893905-123893927
Sequence AGGGAGAGTGCAGATACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937613670_937613677 28 Left 937613670 2:123893905-123893927 CCCCCAGTATCTGCACTCTCCCT No data
Right 937613677 2:123893956-123893978 CATACCCCCTTGCCAGTGTATGG No data
937613670_937613678 29 Left 937613670 2:123893905-123893927 CCCCCAGTATCTGCACTCTCCCT No data
Right 937613678 2:123893957-123893979 ATACCCCCTTGCCAGTGTATGGG No data
937613670_937613679 30 Left 937613670 2:123893905-123893927 CCCCCAGTATCTGCACTCTCCCT No data
Right 937613679 2:123893958-123893980 TACCCCCTTGCCAGTGTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937613670 Original CRISPR AGGGAGAGTGCAGATACTGG GGG (reversed) Intergenic
No off target data available for this crispr