ID: 937617230

View in Genome Browser
Species Human (GRCh38)
Location 2:123940454-123940476
Sequence CAGATCATGGAGAAGAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937617230_937617234 4 Left 937617230 2:123940454-123940476 CCTCATTTCTTCTCCATGATCTG No data
Right 937617234 2:123940481-123940503 TGTTTTTCATGGAAGGCCTTAGG No data
937617230_937617233 -3 Left 937617230 2:123940454-123940476 CCTCATTTCTTCTCCATGATCTG No data
Right 937617233 2:123940474-123940496 CTGAATTTGTTTTTCATGGAAGG No data
937617230_937617232 -7 Left 937617230 2:123940454-123940476 CCTCATTTCTTCTCCATGATCTG No data
Right 937617232 2:123940470-123940492 TGATCTGAATTTGTTTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937617230 Original CRISPR CAGATCATGGAGAAGAAATG AGG (reversed) Intergenic
No off target data available for this crispr