ID: 937620201

View in Genome Browser
Species Human (GRCh38)
Location 2:123976626-123976648
Sequence ATTCACGGATGGGAATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937620201_937620207 -1 Left 937620201 2:123976626-123976648 CCCTAAAATTCCCATCCGTGAAT No data
Right 937620207 2:123976648-123976670 TTTTTGTCCTGGAGAAACAAAGG No data
937620201_937620209 3 Left 937620201 2:123976626-123976648 CCCTAAAATTCCCATCCGTGAAT No data
Right 937620209 2:123976652-123976674 TGTCCTGGAGAAACAAAGGGAGG No data
937620201_937620208 0 Left 937620201 2:123976626-123976648 CCCTAAAATTCCCATCCGTGAAT No data
Right 937620208 2:123976649-123976671 TTTTGTCCTGGAGAAACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937620201 Original CRISPR ATTCACGGATGGGAATTTTA GGG (reversed) Intergenic
No off target data available for this crispr