ID: 937620202

View in Genome Browser
Species Human (GRCh38)
Location 2:123976627-123976649
Sequence AATTCACGGATGGGAATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937620202_937620207 -2 Left 937620202 2:123976627-123976649 CCTAAAATTCCCATCCGTGAATT No data
Right 937620207 2:123976648-123976670 TTTTTGTCCTGGAGAAACAAAGG No data
937620202_937620208 -1 Left 937620202 2:123976627-123976649 CCTAAAATTCCCATCCGTGAATT No data
Right 937620208 2:123976649-123976671 TTTTGTCCTGGAGAAACAAAGGG No data
937620202_937620209 2 Left 937620202 2:123976627-123976649 CCTAAAATTCCCATCCGTGAATT No data
Right 937620209 2:123976652-123976674 TGTCCTGGAGAAACAAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937620202 Original CRISPR AATTCACGGATGGGAATTTT AGG (reversed) Intergenic
No off target data available for this crispr