ID: 937620207

View in Genome Browser
Species Human (GRCh38)
Location 2:123976648-123976670
Sequence TTTTTGTCCTGGAGAAACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937620202_937620207 -2 Left 937620202 2:123976627-123976649 CCTAAAATTCCCATCCGTGAATT No data
Right 937620207 2:123976648-123976670 TTTTTGTCCTGGAGAAACAAAGG No data
937620201_937620207 -1 Left 937620201 2:123976626-123976648 CCCTAAAATTCCCATCCGTGAAT No data
Right 937620207 2:123976648-123976670 TTTTTGTCCTGGAGAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937620207 Original CRISPR TTTTTGTCCTGGAGAAACAA AGG Intergenic
No off target data available for this crispr