ID: 937620603

View in Genome Browser
Species Human (GRCh38)
Location 2:123980675-123980697
Sequence CCCAACCCTGGCTGCTTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937620603_937620613 7 Left 937620603 2:123980675-123980697 CCGTGAAAGCAGCCAGGGTTGGG No data
Right 937620613 2:123980705-123980727 GGTACACCCTGCAAAGCCACAGG 0: 2
1: 41
2: 355
3: 1551
4: 2192
937620603_937620614 8 Left 937620603 2:123980675-123980697 CCGTGAAAGCAGCCAGGGTTGGG No data
Right 937620614 2:123980706-123980728 GTACACCCTGCAAAGCCACAGGG 0: 2
1: 24
2: 345
3: 1504
4: 1872
937620603_937620619 24 Left 937620603 2:123980675-123980697 CCGTGAAAGCAGCCAGGGTTGGG No data
Right 937620619 2:123980722-123980744 CACAGGGATGGAGCTTCCCAAGG 0: 4
1: 67
2: 334
3: 620
4: 1152
937620603_937620615 12 Left 937620603 2:123980675-123980697 CCGTGAAAGCAGCCAGGGTTGGG No data
Right 937620615 2:123980710-123980732 ACCCTGCAAAGCCACAGGGATGG 0: 65
1: 639
2: 905
3: 849
4: 854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937620603 Original CRISPR CCCAACCCTGGCTGCTTTCA CGG (reversed) Intergenic
No off target data available for this crispr