ID: 937620612

View in Genome Browser
Species Human (GRCh38)
Location 2:123980687-123980709
Sequence GTACCCCCACCCCCCAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937620612_937620619 12 Left 937620612 2:123980687-123980709 CCAGGGTTGGGGGGTGGGGGTAC No data
Right 937620619 2:123980722-123980744 CACAGGGATGGAGCTTCCCAAGG 0: 4
1: 67
2: 334
3: 620
4: 1152
937620612_937620614 -4 Left 937620612 2:123980687-123980709 CCAGGGTTGGGGGGTGGGGGTAC No data
Right 937620614 2:123980706-123980728 GTACACCCTGCAAAGCCACAGGG 0: 2
1: 24
2: 345
3: 1504
4: 1872
937620612_937620615 0 Left 937620612 2:123980687-123980709 CCAGGGTTGGGGGGTGGGGGTAC No data
Right 937620615 2:123980710-123980732 ACCCTGCAAAGCCACAGGGATGG 0: 65
1: 639
2: 905
3: 849
4: 854
937620612_937620613 -5 Left 937620612 2:123980687-123980709 CCAGGGTTGGGGGGTGGGGGTAC No data
Right 937620613 2:123980705-123980727 GGTACACCCTGCAAAGCCACAGG 0: 2
1: 41
2: 355
3: 1551
4: 2192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937620612 Original CRISPR GTACCCCCACCCCCCAACCC TGG (reversed) Intergenic
No off target data available for this crispr