ID: 937620619

View in Genome Browser
Species Human (GRCh38)
Location 2:123980722-123980744
Sequence CACAGGGATGGAGCTTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2177
Summary {0: 4, 1: 67, 2: 334, 3: 620, 4: 1152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937620612_937620619 12 Left 937620612 2:123980687-123980709 CCAGGGTTGGGGGGTGGGGGTAC No data
Right 937620619 2:123980722-123980744 CACAGGGATGGAGCTTCCCAAGG 0: 4
1: 67
2: 334
3: 620
4: 1152
937620603_937620619 24 Left 937620603 2:123980675-123980697 CCGTGAAAGCAGCCAGGGTTGGG No data
Right 937620619 2:123980722-123980744 CACAGGGATGGAGCTTCCCAAGG 0: 4
1: 67
2: 334
3: 620
4: 1152
937620599_937620619 29 Left 937620599 2:123980670-123980692 CCAGCCCGTGAAAGCAGCCAGGG No data
Right 937620619 2:123980722-123980744 CACAGGGATGGAGCTTCCCAAGG 0: 4
1: 67
2: 334
3: 620
4: 1152
937620601_937620619 25 Left 937620601 2:123980674-123980696 CCCGTGAAAGCAGCCAGGGTTGG No data
Right 937620619 2:123980722-123980744 CACAGGGATGGAGCTTCCCAAGG 0: 4
1: 67
2: 334
3: 620
4: 1152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937620619 Original CRISPR CACAGGGATGGAGCTTCCCA AGG Intergenic
Too many off-targets to display for this crispr