ID: 937626480

View in Genome Browser
Species Human (GRCh38)
Location 2:124049898-124049920
Sequence CTGTAATCTCACATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937626476_937626480 14 Left 937626476 2:124049861-124049883 CCTGCTTGCTTCTTGGTTTATAG No data
Right 937626480 2:124049898-124049920 CTGTAATCTCACATGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937626480 Original CRISPR CTGTAATCTCACATGGTGGA GGG Intronic
No off target data available for this crispr