ID: 937627859

View in Genome Browser
Species Human (GRCh38)
Location 2:124063995-124064017
Sequence ACATAGTTGTCTGCAGCAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937627859_937627861 5 Left 937627859 2:124063995-124064017 CCCGTTGCTGCAGACAACTATGT No data
Right 937627861 2:124064023-124064045 ACACACAGACAGCCAGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937627859 Original CRISPR ACATAGTTGTCTGCAGCAAC GGG (reversed) Intronic
No off target data available for this crispr