ID: 937627861

View in Genome Browser
Species Human (GRCh38)
Location 2:124064023-124064045
Sequence ACACACAGACAGCCAGACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937627859_937627861 5 Left 937627859 2:124063995-124064017 CCCGTTGCTGCAGACAACTATGT No data
Right 937627861 2:124064023-124064045 ACACACAGACAGCCAGACTTAGG No data
937627858_937627861 24 Left 937627858 2:124063976-124063998 CCTAAGAAAACATATTGCTCCCG No data
Right 937627861 2:124064023-124064045 ACACACAGACAGCCAGACTTAGG No data
937627860_937627861 4 Left 937627860 2:124063996-124064018 CCGTTGCTGCAGACAACTATGTT No data
Right 937627861 2:124064023-124064045 ACACACAGACAGCCAGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937627861 Original CRISPR ACACACAGACAGCCAGACTT AGG Intronic
No off target data available for this crispr