ID: 937633815

View in Genome Browser
Species Human (GRCh38)
Location 2:124133285-124133307
Sequence TTGTTTTTTTTAAGGACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937633815_937633817 -9 Left 937633815 2:124133285-124133307 CCTTTGGTCCTTAAAAAAAACAA No data
Right 937633817 2:124133299-124133321 AAAAAACAAAACAAAAAAAAAGG 0: 16
1: 226
2: 24014
3: 29905
4: 64269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937633815 Original CRISPR TTGTTTTTTTTAAGGACCAA AGG (reversed) Intronic
No off target data available for this crispr