ID: 937635048

View in Genome Browser
Species Human (GRCh38)
Location 2:124146052-124146074
Sequence TTGTCCTATCTGCTTTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937635048_937635055 15 Left 937635048 2:124146052-124146074 CCCACTTAAAGCAGATAGGACAA No data
Right 937635055 2:124146090-124146112 CTAACAAAGAGAAAGGGAGATGG No data
937635048_937635057 28 Left 937635048 2:124146052-124146074 CCCACTTAAAGCAGATAGGACAA No data
Right 937635057 2:124146103-124146125 AGGGAGATGGAGGCACAGAGAGG No data
937635048_937635056 18 Left 937635048 2:124146052-124146074 CCCACTTAAAGCAGATAGGACAA No data
Right 937635056 2:124146093-124146115 ACAAAGAGAAAGGGAGATGGAGG No data
937635048_937635053 9 Left 937635048 2:124146052-124146074 CCCACTTAAAGCAGATAGGACAA No data
Right 937635053 2:124146084-124146106 TACCTGCTAACAAAGAGAAAGGG No data
937635048_937635052 8 Left 937635048 2:124146052-124146074 CCCACTTAAAGCAGATAGGACAA No data
Right 937635052 2:124146083-124146105 ATACCTGCTAACAAAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937635048 Original CRISPR TTGTCCTATCTGCTTTAAGT GGG (reversed) Intronic
No off target data available for this crispr