ID: 937638062

View in Genome Browser
Species Human (GRCh38)
Location 2:124179233-124179255
Sequence CCTGGGAGGCAGAAGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937638062_937638071 17 Left 937638062 2:124179233-124179255 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 937638071 2:124179273-124179295 CCTTAGCCTCCTGAGTAGCTGGG 0: 3769
1: 105626
2: 210490
3: 240684
4: 150489
937638062_937638073 25 Left 937638062 2:124179233-124179255 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 937638073 2:124179281-124179303 TCCTGAGTAGCTGGGATTACAGG 0: 53511
1: 140483
2: 228049
3: 201895
4: 144651
937638062_937638069 16 Left 937638062 2:124179233-124179255 CCCTGCAACTTCTGCCTCCCAGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
Right 937638069 2:124179272-124179294 GCCTTAGCCTCCTGAGTAGCTGG 0: 2931
1: 92302
2: 198207
3: 231078
4: 156316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937638062 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr