ID: 937638335

View in Genome Browser
Species Human (GRCh38)
Location 2:124183023-124183045
Sequence ATAAATAAGCAAAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937638335_937638339 9 Left 937638335 2:124183023-124183045 CCCTCCACCTTTTGCTTATTTAT No data
Right 937638339 2:124183055-124183077 TTGTACCAACCCTTTATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937638335 Original CRISPR ATAAATAAGCAAAAGGTGGA GGG (reversed) Intronic
No off target data available for this crispr