ID: 937646815

View in Genome Browser
Species Human (GRCh38)
Location 2:124274852-124274874
Sequence AGCTGCTTAAAGAAGTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937646815_937646817 -5 Left 937646815 2:124274852-124274874 CCATCTGACTTCTTTAAGCAGCT No data
Right 937646817 2:124274870-124274892 CAGCTGTGCCCATAAATAAAGGG No data
937646815_937646816 -6 Left 937646815 2:124274852-124274874 CCATCTGACTTCTTTAAGCAGCT No data
Right 937646816 2:124274869-124274891 GCAGCTGTGCCCATAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937646815 Original CRISPR AGCTGCTTAAAGAAGTCAGA TGG (reversed) Intronic
No off target data available for this crispr