ID: 937647693

View in Genome Browser
Species Human (GRCh38)
Location 2:124284302-124284324
Sequence AACCATTTCTAGATGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937647688_937647693 -2 Left 937647688 2:124284281-124284303 CCACAAGGCTACTGCCTGGGGAA No data
Right 937647693 2:124284302-124284324 AACCATTTCTAGATGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937647693 Original CRISPR AACCATTTCTAGATGGGTCA GGG Intronic
No off target data available for this crispr