ID: 937652499

View in Genome Browser
Species Human (GRCh38)
Location 2:124336252-124336274
Sequence AAAATTGGACCCCTTTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937652499_937652508 12 Left 937652499 2:124336252-124336274 CCTCCCTAAAGGGGTCCAATTTT No data
Right 937652508 2:124336287-124336309 AGTGGCCAGTCTGAAAAGACTGG No data
937652499_937652505 -6 Left 937652499 2:124336252-124336274 CCTCCCTAAAGGGGTCCAATTTT No data
Right 937652505 2:124336269-124336291 AATTTTTGGGTCCTGCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937652499 Original CRISPR AAAATTGGACCCCTTTAGGG AGG (reversed) Intronic
No off target data available for this crispr