ID: 937656195

View in Genome Browser
Species Human (GRCh38)
Location 2:124379655-124379677
Sequence AAAATGTTAGCAGCAACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937656195_937656204 28 Left 937656195 2:124379655-124379677 CCTTGGGTTGCTGCTAACATTTT No data
Right 937656204 2:124379706-124379728 GGTCTGGCAGCGCCCTCACAAGG No data
937656195_937656198 -7 Left 937656195 2:124379655-124379677 CCTTGGGTTGCTGCTAACATTTT No data
Right 937656198 2:124379671-124379693 ACATTTTATTAACTTGGGCATGG No data
937656195_937656205 29 Left 937656195 2:124379655-124379677 CCTTGGGTTGCTGCTAACATTTT No data
Right 937656205 2:124379707-124379729 GTCTGGCAGCGCCCTCACAAGGG No data
937656195_937656200 12 Left 937656195 2:124379655-124379677 CCTTGGGTTGCTGCTAACATTTT No data
Right 937656200 2:124379690-124379712 ATGGCCTCCCTTGTGAGGTCTGG No data
937656195_937656199 7 Left 937656195 2:124379655-124379677 CCTTGGGTTGCTGCTAACATTTT No data
Right 937656199 2:124379685-124379707 TGGGCATGGCCTCCCTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937656195 Original CRISPR AAAATGTTAGCAGCAACCCA AGG (reversed) Intronic
No off target data available for this crispr